Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Circular RNA-100219 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Breast Cancer | ICD-10 | Malignant neoplasm of breast (C50) |
DBLink | PMID | 31127997 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | Breast cancer and paracancer tissues were surgically resected from 48 patients |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TGCTACAGACGACTCAGAGA ReverseAGATGATGAAGGTGGTGGCA | Statistics | Fold Change : Downregulated pvalue : <0.05 |
Citation | |||
Yao, Y, Fang, ZZXHSLCNH (2019). Circular RNA-100219 promotes breast cancer progression by binding to microRNA-485-3p. J BUON, 24, 2:501-508. |